Conclusion
: The rise in CC-chemokine receptor 7 may need been a response to probiotic remedy. As a comparatively small pattern was used to conduct this examine, our analysis must be replicated in several settings, and over time, to supply comparable findings.
Outcomes
: We discovered elevated expression of CC-chemokine receptor 7 in infants handled with the probiotic, however not the controls ( p < 0.0026). No variations have been noticed for interleukin 10 after the examine interval in both group. At baseline, every day crying time was comparable within the probiotic and management teams: 341 (25) vs. 337 (29) min., respectively ( p = 0.450). After 28 days, every day imply crying time lower statistically within the probiotic group: 78 (23) vs. 232 (31), respectively ( p < 0.001). Strategies: Our College hospital in Turin recruited 50 wholesome outpatients, at a median age of roughly 1 month, from September 2017 to August 2018. They have been randomized to every day Lactobacillus reuteri DSM17938 (1 × 10 8 cfu) or a placebo for 28 days from recruitment. We collected peripheral blood and evaluated the expression of CCR7 messenger ribonucleic acid utilizing the real-time TaqMan reverse transcription polymerase chain response methodology at baseline and after the examine interval. Goal: Research have proven that Lactobacilli reute ri probiotics can have an effect on cells that play a key position within the immune system. This in vivo Italian examine investigated how Lactobacillus reuteri DSM 17938 influenced CC-chemokine receptor 7 (CCR7) and interleukin 10 (IL-10) in breastfed colicky infants.
References – L Reuteri Probiotics For Infants
• Lactobacilli reuteri can have an effect on cells that play a key position within the immune system.
• This in vivo examine investigated how Lactobacillus reuteri DSM 17938 influenced CC-chemokine receptor 7 (CCR7) and interleukin 10 (IL-10) in 50 colicky breastfed infants.
• We discovered elevated expression of CC-chemokine receptor 7 in infants randomized to the probiotic, however not placebo, group and no variations in interleukin 10 in both group.
Introduction
Inflammatory mediators, resembling cytokines, chemokines and chemokines receptors, have been linked to immune system alterations they usually show a substantial quantity of similarity of perform in infants (1). Nevertheless, their exact mechanisms in formative years should not totally understood.
Traditionally, neonates have been assumed to be poor in regulatory T cells and different adaptive immune cells, however additional analysis has been carried out on this space within the final decade (2).
Chemokine receptors are concerned in organizing thymic structure and performance and lymph-node homing of naive and regulatory T cells. In addition they affect irritation, significantly chemokine receptor sort 7 (CCR7), which is crucial for the directed migration of adaptive immune cells, and regulatory T cell era (3). The CCR7 signaling system has been implicated in numerous organic processes, resembling lymph node homeostasis, T cell activation, immune tolerance and inflammatory responses (3)
CCR7 is a member of the G protein-coupled receptor household (syn CD197). It’s activated by two totally different ligands, chemokine ligand 19 and chemokine ligand 21, and is concerned within the migration, activation and survival of a number of cell varieties, together with dendritic cells, T cells, eosinophils, B cells and endothelial cells (4).
Interleukin-10 (IL-10) is arguably probably the most potent anti-inflammatory cytokine and it’s produced by practically all the innate and adaptive immune cells. IL-10 performs an necessary position within the upkeep of intestine homeostasis, because of its anti-inflammatory features. Throughout an an infection, IL-10 inhibits the exercise of sort 1 T helper cells, pure killer cells, and macrophages, that are required for optimum pathogen clearance, and contribute to tissue harm (5).
In infants, the mucosal immune system is continually uncovered to a variety of commensal and probably pathogenic microbial species. Intestinal intraepithelial lymphocytes present a primary line of safety and investigating their position in immunity is important (6).
Rising proof helps the idea that toddler colic might signify intestine irritation and microbial dysbiosis (7, 8). Lactobacilli are extensively used as probiotics and have been proven to have helpful results on diarrhea that’s related to infections (9). Nevertheless, they’ve additionally been utilized in scientific trials which have examined necrotising enterocolitis (10), inflammatory bowel ailments, and childish colic (11).
Probiotics present helpful micro organism and clinicians use them as a result of they will enhance modifications within the intestinal microbiota and affect the immunological standing of the host (9).
The helpful impact of probiotics are mediated by a number of mechanisms, resembling immune receptor cascade signaling and cytokines and toll like receptors (10) modulating irritation and gene networks regulating manufacturing of bacterial-derived immunoregulatory molecules (12).
In a examine printed in 2018 we reported that infants with colic who have been handled with Lactobacilli reuteri DSM17938 for 30 days demonstrated a major lower in calprotectin values and crying time. The infants additionally confirmed elevated forkhead field P3 concentrations and these resulted in a decreased retinoic acid-related orphan receptor T and forkhead field P3 ratio (13), whereas the expression of mRNA expression of Toll like receptor 2 and Toll like receptor 4 appear not influenced (14). An in vitro examine Cervantes -Barragan reported that molecular mechanisms responded to the inflammatory standing of the intestine throughout remedy with Lactobacillus reuteri (15).
Certainly one of these regulatory molecules is the IL-10, which is an anti-inflammatory cytokine and its results have been demonstrated in research in each mice and people (14). Certainly, IL-10 signaling is crucial for intestinal homeostasis, significantly in macrophages. IL-10 dampens intestinal irritation and it could be attention-grabbing to know if it may be modulated by probiotic remedy (16, 17).
The purpose of the current examine was to research CCR7 and IL-10 in breastfed colicky infants handled with Lactobacillus reuteri DSM 17938 for 28 days.
Sufferers and Strategies
Topics and Strategies
This examine was carried out on the Division of Pediatrics, Regina Margherita Youngsters Hospital, Turin, Italy, between September 2017 and August 2018. We recruited 50 full-term solely breastfed infants aged <50 days and randomized equal numbers to obtain both Lactobacillus reuteri DSM 17938 of a placebo for 28 days. The median age of the probiotic group at recruitment was 28.5 days and it was 32.5 days for the placebo group. They have been included in the event that they have been born at a gestational age of between 37 and 40 weeks, with a delivery weight of between 2,500 and 4,000 g and a 5-min Apgar rating of greater than seven. All of the infants had colic and underwent blood assessments throughout routine outpatient examinations. We used the modified Wessel's standards for the analysis of childish colic (13). The examine protocol was permitted by the native Moral Committee at Ospedale Mauriziano—Ospedale Childish Regina Margherita—S. Anna Torino, and the infants' dad and mom offered written consent to take part within the examine.
Pattern Assortment Venous blood samples have been collected from the infants at 8 a.m., after a 3 h fasting interval, which coincided with routine scientific blood sampling to reduce the disturbance to the infants. A tube of haemachrome was collected at recruitment, specifically day 1 of the examine interval, for every toddler and on the management go to after 28 days. Every pattern was transferred to sterile Eppendorf tubes (Merck KGaA, Darmstadt, Germany) and saved in a freezer at −80°C till they have been wanted. Intervention The infants have been randomized to obtain the probiotic Lactobacilli reuteri DSM 17938 or placebo every day for 28 days utilizing a pc programme. The energetic examine product consisted of a suspension of freeze-dried Lactobacilli reuteri DSM 17938 in a combination of sunflower oil and a medium-chain triglyceride oil, which was provided in a 5 ml darkish bottle fitted with a dropper cap. 5 drops of the formulation delivered the every day dose of Lactobacilli reuteri 1 × 108 colony forming models and this was given 30 min earlier than feeding. Each the Lactobacilli reuteri and placebo examine merchandise have been offered by the Italian distributor (Nòos Srl, Roma, Italy). This oil suspension is steady for 21 months at 2°C to eight°C, as documented by the producer (BioGaia AB, Stockholm. Sweden). Through the examine, dad and mom have been instructed to maintain the product within the fridge when it was not in use. Topics acquired the examine product freed from cost after enrolment. Every kid's pediatrician was knowledgeable, in writing, of the kid's participation and fogeys got a cellphone quantity in order that they might ask the analysis staff questions and report any perceived issues or considerations through the examine. Comply with-Up Section Every participant was given a bodily examination at enrolment, on day 1 and on day 28. The dad and mom accomplished a every day questionnaire at some stage in the examine, which included the next information on the overall well being standing of the toddler, specifically the incidence of any sickness and using antibiotics or different remedy. It additionally included gastrointestinal indicators and associated signs, resembling crying time, vomiting and regurgitation, and stooling habits. Individuals move by way of examine are reported in Determine 1. FIGURE 1 Determine 1. Circulate diagram. Ribonucleic Acid (RNA) Extraction Whole RNA was extracted from 200 μl of blood utilizing a Maxwell automated extractor (Promega, Wisconsin, USA) and the simplyRNA Blood Equipment protocol (Promega) with out modification. One microgram of whole RNA was reverse-transcribed with 8 μl of 10X buffer, 4.8 μl of 25 mM MgCl 2 , 2 μl of ImpromII (Promega), 1 μl of 40 U/l RNase inhibitor, 0.4 μl of 250 μM random hexamers (Promega), 2 μl of dNTP combine at 100 mM every (Promega) and double distilled water to create a last quantity of 20 μl. The response was carried out utilizing a GeneAmp PCR system 9700 Thermal Cycler (Utilized Biosystems, California, USA) utilizing the next circumstances: 5 min at 25°C, 60 min at 42°C and 15 min at 70°C for enzyme inactivation. The complementary deoxyribonucleic acid (DNA) was saved at −80° till use. Relative Quantification by Actual-Time Polymerase Chain Response (PCR) Relative quantification of the messenger RNA expression ranges of the chosen genes was achieved utilizing TaqMan amplification (Lifetechnologies, Texas, USA) and normalization to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) because the reference gene. This was achieved utilizing an ABI PRISM 7500 real-time system (Life Applied sciences, Texas, USA). The mRNA messenger RNA expression ranges of CC R7 and IL10 have been quantified utilizing real-time PCR. Roughly 100 ng of cDNAcomplementary DNA was amplified in a complete quantity of 20 μl containing 2 × GoTaq® qPCR Grasp Combine (Promega, Madison, WI), 500 nmol of particular primers and 200 nmol of probe. Had been used: CCR7 primers (CCR7F-5′- GCAACTCAACATCGCCTACG−3′)(CCR7R-5′- GAAGAGATCGTTGCGGAACTT−3′) and probe (CCR7P-6FAM- accctttcttgtacgccttcatcgg -TAMRA); IL10 primers (IL10F-5′- ATGAAGGATCAGCTGGACAACTT−3′) (IL10R-5′- CCTTGATGTCTGGGTCTTGGT-3′) and probe (IL10P-6FAM- ACCTGGGTTGCCAAGCCTTGTCTG -TAMRA); GAPDH primers (GAPDHF-5′-CCAAGGTCATCCATGACAAC-3′) (GAPDHR-5′- GTGGCAGTGATGGCATGGAC-3′) and probe (GAPDH-6FAM- TGGTATCGTGGAAGGA-3′ MGB). The amplifications have been carried out in a 96-well plate at 95°C for two min, adopted by 40 cycles of 95°C for 15 s and 60°C for 1 min. Every pattern was run in triplicate. The goal gene relative expression in sufferers was in contrast with regular samples utilizing the 2-ΔΔCt methodology, and the relative expression is expressed in arbitrary models (AU). The messenger RNA expression ranges of CCR7 and IL10 and GAPDH have been quantified by real-time PCR, as beforehand described by Mareschi et al. (18). Statistical Evaluation The pattern dimension was calculated on the premise that we needed to discover a 50 min discount in every day common crying time within the probiotic group, when it was in comparison with the placebo group. This was thought-about a clinically related distinction and was primarily based on earlier research. We calculated that 20 sufferers have been wanted in every group, primarily based on an alpha worth of 0.05, beta worth of 0.20 and an estimated normal deviation (SD) inside the teams of fifty min crying time. We determined to enroll 25 topics per group to permit for a 20% drop-out charge. Randomization was carried out by the random-digit methodology, utilizing computer-generated numbers. We used a two-treatment randomization scheme with random blocks of various dimension, using Stata Statistical Software program, Launch 9 (StataCorp LP, School Station, Texas, USA) and the ralloc process. Information have been analyzed by SPSS, model 16 (SPSS Inc, Illinois, USA), whereas the pattern dimension calculation was carried out by NCSS-PASS 2000 (Quantity Cruncher Statistical Programs, Utah, USA). Information are proven as means and normal deviations (SD) or medians and interquartile ranges (IQR) for steady variables, as applicable, and numbers and percentages for categorical variables. Variations between the teams have been evaluated utilizing the Scholar's t-test for paired samples, whereas associations between the explicit variables have been evaluated by Fisher's actual check. The Wilcoxon signed-rank check and Friedman check have been used to judge variations between paired samples for steady variables, when applicable. All reported p-values have been two-sided and variations have been thought-about to be vital when p < 0.05.Outcomes
A complete of fifty infants have been enrolled to the examine and allotted, based on the protocol, to obtain the Lactobacilli reuteri DSM17938 probiotic or placebo. The traits of the themes enrolled and handled with the probiotic and the placebo are reported in Desk 1. There have been no vital variations between teams at baseline (Desk 1). We excluded six infants from the evaluation due to ample blood samples: 4 within the probiotic group and two within the placebo group.
TABLE 1
Desk 1. Baseline traits of the individuals within the two examine teams.
The first end result was the measurement of the expression degree of CC-chemokine receptor 7 messenger RNA within the examine group at day 1 and at day 28.
The CC-chemokine receptor 7 values within the probiotic group on day 1 was 2.73 ± 1.1 ΔCt and on day 28 it was 1.82±1.45 ΔCt. Compared, the CC-chemokine receptor 7 values within the placebo group was 1.86±1.1 ΔCt on day 1 and 1.21±0.6 ΔCt on day 28 (Desk 2).
TABLE 2
Desk 2. Blood inflammatory markers (ΔCt), in toddler with colic at enrolment and after 28 days of supplementation with L. reuteri or Placebo.
After the examine interval CC-chemokine receptor 7 have been expressed at larger ranges within the probiotic group than within the placebo group (p = 0.0020) (Determine 2).
FIGURE 2
Determine 2. CCR7 and IL10 transcriptional ranges within the venous blood of group handled with L Reuteri DSM 17938. Information are represented as circle plots (day 1) and field plots (day 28), with horizontal traces depicting the averages. Relative messenger RNA ranges have been analyzed by real-time PCR and represented by ΔCt. The Paired t-test was carried out.
After we analyzed the placebo group we didn’t observe totally different CCR7 expression on day 1 and on day 28 (p = 0.26) (information not proven).
Secondary Final result
The values of IL-10 within the probiotic group have been 8.64 ± 1.32 ΔCt on day 1, and eight.84 ± 2.31 ΔCt on day 28 (p = 0.6552)(Determine 2). The values within the placebo group have been 8.61 ± 1.40 ΔCt on day 1 and 9.31 ± 1.30 ΔCt on day 28 (p = 0.62) (information not proven). At day 28, IL10 was equally expressed within the probiotic (Determine 2) and management teams (p = 0.4375) (information not proven).
Crying time of infants handled with L. reuteri or Placebo are reported in Desk 3.
TABLE 3
Desk 3. Crying and fussing time (imply minutes per days) at day 1 and at day 28 in placebo and L. reuteri group.
After L. reuteri administration for 28 days in infants with colic, we noticed a major lower of every day crying time (341.55 ± 25.80 min/day at day 0 vs. 78.34 ± 23.24 min/day at day 28, p = 0.001) (Desk 3).
We performed on response variable (crying time) an ITT (Intention to Deal with) evaluation too, together with 4 infants dropped out. As they have been all from the Placebo group we labeled them as responders.
Infants Responders (with a discount of fifty% in crying time from baseline) have been considerably larger within the L. reuteri group vs. placebo group on days 28 (21 vs. 11, p = 0.007).
Dialogue
The position of the principle cytokines, chemokines and their receptors within the pathophysiology of problems that contain irritation in an rising difficulty of energetic analysis (15, 16, 19–22).
Intestine microbiota and its metabolites have been proven to affect immune features and immune homeostasis inside the intestine, significantly through the first few months of life. As well as, probiotics have been proven to impact immunity all through cytokines and the manufacturing of metabolites resembling tryptophan (15). Haileselassie et al. reported that Lactobacillus reuteri was in a position to affect the era of monocyte-derived dendritic cells and subsequent autologous T cell responses (23).
However an in vitro examine by Cervantes et al. demonstrated that Lactobacillus reuteri induced intestine intraepithelial CD4(+)CD8αα(+) T cells (15).
The immunological mechanism behind the results of probiotic resembling Lactobacillus reuteri are most likely regulatory T cells cell, as earlier research have reported (13, 14, 22, 23).
In actual fact Yuying et al. confirmed that Lactobacillus reuteri DSM 17938 modified the frequency of forkhead field P3 ratio regulatory T cells within the gut and mesenteric lymph node in experimental necrotising enterocolitis (24).
Whereas the exact mechanism is unclear, we will argue that the response between Lactobacillus reuteri and each epithelial and non-epithelial enteric cells have to be energetic in modulating intrinsic anti-inflammatory results within the gut, as proven in animal fashions in vivo (23–27).
On this examine we confirmed that Lactobacillus. reuteri 17938 was efficient in alleviation of crying time because of colic in breast fed infants. Our outcomes are in step with the current meta-analysis of earlier 4 randomized trials (11).
Our findings confirmed additionally an elevated expression of CC-chemokine receptor 7 in infants handled with Lactobacilli reuteri DSM 17938 after 28 days (p = < 0.0020), in comparison with day 1, whereas no variations the place noticed for IL-10 values. CCR7 is concerned in environment friendly induction of immune reactions in addition to their silencing and regulation. A lot of the data on the involvement of CCR7 within the improvement of immunity and tolerance has been derived from mouse fashions and information on CCR7 perform in people is moderately sparse (3, 4). Nevertheless, it has been found that CCR7 contributes to the induction and upkeep of tolerance and this implies a potential new technique for remedy utilizing probiotics. CCR7 has lately been proven to be up-regulated in peripheral blood DCs and in DCs derived from monocytes and CD34 progenitor cells after activation with a wide range of brokers (28). Our in vivo outcomes utilizing peripheral blood mononuclear cells from handled infants with L reuteri confirmed up-regulation of CCR7 expression ranges. that the baseline ranges of CCR7 have been low. These outcomes, preliminary in nature, are in step with the speculation that degree of expression of CCR7 perhaps the response to recruitment to intestine lymphatics methods. Whereas our information counsel that IL-10 cytokines appear not be concerned by probiotic supplementation, however a bigger pattern is important to verify our observations, which have been echoed by an animal examine carried out by Yan et al. (29). Power and Limitations There have been some limitations to our examine. First, since this was an experimental examine, it solely supplies preliminary information. It's troublesome to acquire detailed info on many components when finishing up a pilot examine with a small variety of topics. That's the reason it's obligatory to regulate for the results of extraneous variables that may end in deceptive interpretations of causality. Consequently, the findings of this examine can't be generalized. Nevertheless, to one of the best of our data that is the primary analysis examine that investigated CCR7 in wholesome breastfed infants handled with Lactobacillus reuteri DSM 17938 in comparison with a placebo utilizing actual time PCR. Tompa et al. reported that cryopreservation of peripheral blood mononuclear cells might have an effect on the expression of CCR7 on regulatory T cells, however we didn't use cytofluorimetry and our information weren't influenced by storage (30). The standardized method that we used permits the examine to be replicated in several settings, or over time, to supply comparable findings.
Conclusion
Our randomized examine of breastfed infants with colic discovered a decreased crying time and an elevated expression of CC-chemokine receptor 7 in infants handled with the probiotic Lactobacillus reuteri DSM 17938 for 28 days, however not the placebo group. No variations have been noticed for interleukin 10 after the examine interval in both group. The rise in CC-chemokine receptor 7 may need been a response to probiotic remedy.
Understanding the potential impact of probiotic dietary supplements, significantly through the first few weeks of life, is attention-grabbing and will additionally assist to induce oral tolerance. Future research on CCR7 in human molecular drugs, in addition to extra refined microbiota fashions of site-specific and inducible CCR7 and the CCR7-ligand, will assist our understanding of this necessary molecular pathway. It’s going to additionally support our understanding of the mobile responses pushed by it throughout probiotic remedy. Profiting from these new options could result in a tailor-made method for regulatory T cells utilizing probiotic remedy.
Information Availability
The uncooked information supporting the conclusions of this manuscript will likely be made accessible by the authors, with out undue reservation, to any certified researcher.
Ethics Assertion
The examine protocol was permitted by the native Moral Committee at Ospedale Mauriziano—Ospedale Childish Regina Margherita–S. Anna Torino, and the infants’ dad and mom offered written consent to take part within the examine.
Creator Contributions
FS had major duty for protocol improvement as principal investigator and wrote the manuscript. IG carried out PCR evaluation and helped to put in writing the manuscript. AS analyzed information and wrote the manuscript, edited references. VD carried out PCR evaluation and helped to put in writing the manuscript. PM carried out PCR evaluation and helped to put in writing the manuscript. CC carried out evaluation and wrote the manuscript. MB carried out the ultimate information evaluation, supervised evaluation and helped to put in writing the manuscript.
Funding
This examine was supported by Noos S.r.L. 00181 Roma, Italy. The funders had no position within the design and conduct of the examine; assortment, administration, evaluation, and interpretation of the information; preparation, evaluate, or approval of the manuscript; and resolution to submit the manuscript for publication.
Disclaimer
The content material is solely the duty of the authors.
Battle of Curiosity Assertion
The authors declare that the analysis was performed within the absence of any business or monetary relationships that may very well be construed as a possible battle of curiosity.
Acknowledgments
The authors are grateful to Annette Whibley of Wizard Communications for enhancing the manuscript.
Abbreviations
CCR7, chemokine receptor sort 7; IL10, interleukin 10; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; DNA, deoxyribonucleic acid; RNA, ribonucleic acid; PCR, polymerase chain response.
References
7. Mai T, Fatheree NY, Gleason W, Liu Y, Rhoads JM. Childish colic: new insights into an outdated downside. Gastroenterol Clin North Am. (2018) 47:829–44. doi: 10.1016/j.gtc.2018.07.008 PubMed Summary | CrossRef Full Textual content | Google Scholar
8. Rhoads JM, Collins J, Fatheree NY, Hashmi SS, Taylor CM, Luo M, et al. Toddler colic represents intestine irritation and dysbiosis. J Pediatr. (2018) 203:55–61. doi: 10.1016/j.jpeds.2018.07.042 PubMed Summary | CrossRef Full Textual content | Google Scholar
10. Hoang TK, He B, Wang T, Tran DQ, Rhoads JM, Liu Y. Protecting impact of Lactobacillus reuteri DSM 17938 towards experimental necrotizing enterocolitis is mediated by Toll-like receptor 2. Am J Physiol Gastrointest Liver Physiol. (2018) 315:G231–40. doi: 10.1152/ajpgi.00084.2017 PubMed Summary | CrossRef Full Textual content | Google Scholar
12. Thomas CM, Saulnier DM, Spinler JK, Hemarajata P, Gao C, Jones SE, et al. Fol C2-mediated folate metabolism contributes to suppression of irritation by probiotic Lactobacillus reuteri. Microbiol Open. (2016) 5:802–18. doi: 10.1002/mbo3.371 CrossRef Full Textual content | Google Scholar
13. Savino F, Garro M, Montanari P, Galliano I, Bergallo M. Crying time and RORγ/FOXP3 expression in Lactobacillus reuteri DSM17938-treated infants with colic: a randomized trial. J Pediatr. (2018) 192:171–7.e1. doi: 10.1016/j.jpeds.2017.08.062 PubMed Summary | CrossRef Full Textual content | Google Scholar
14. Savino F, Galliano I, Garro M, Savino A, Daprà V, Montanari P, et al. Regulatory T cells and Toll-like receptor 2 and 4 mRNA expression in infants with colic handled with Lactobacillus reuteri DSM17938. Benef Microbes. (2018) 8:1–10. doi: 10.3920/BM2017.0194 CrossRef Full Textual content | Google Scholar
18. Mareschi Ok, Castiglia S, Sanavio F, Rustichelli D, Muraro M, Defedele D, et al. Immunoregulatory results on T lymphocytes by human mesenchymal stromal cells remoted from bone marrow, amniotic fluid, and placenta. Exp Hematol. (2016) 44:138–50.e1. doi: 10.1016/j.exphem.2015.10.009 PubMed Summary | CrossRef Full Textual content | Google Scholar
19. Turner MD, Nedjai B, Hurst T, Pennington DJ. Cytokines and chemokines: on the crossroads of cell signalling and inflammatory illness. Biochim Biophys Acta. (2014) 1843:2563–82. doi: 10.1016/j.bbamcr.2014.05.014 PubMed Summary | CrossRef Full Textual content | Google Scholar
21. Gensollen T, Iyer SS, Kasper DL, Blumberg RS. How colonization by microbiota in formative years shapes the immune system. Science. (2016) 352:539–44. doi: 10.1126/science.aad9378 PubMed Summary | CrossRef Full Textual content | Google Scholar
22. Liu Y, Fatheree NY, Mangalat N, Rhoads JM. Human-derived probiotic Lactobacillus reuteri strains differentially scale back intestinal irritation. Am J Physiol Gastrointest Liver Physiol. (2010) 299:1087–96. doi: 10.1152/ajpgi.00124.2010 PubMed Summary | CrossRef Full Textual content | Google Scholar
23. Haileselassie Y, Navis M, Vu N, Qazi KR, Rethi B, Sverremark-Ekström E. Lactobacillus reuteri and Staphylococcus aureus differentially affect the era of monocyte-derived dendritic cells and subsequent autologous T cell responses. Immun Inflamm Dis. (2016) 4:315–26. doi: 10.1002/iid3.115 PubMed Summary | CrossRef Full Textual content | Google Scholar
24. Liu Y, Fatheree NY, Dingle BM, Tran DQ, Rhoads JM. Lactobacillus reuteri DSM 17938 adjustments the frequency of Foxp3+ regulatory T cells within the gut and mesenteric lymph node in experimental necrotizing enterocolitis. PLoS ONE. (2013) 8:e56547. doi: 10.1371/journal.pone.0056547 PubMed Summary | CrossRef Full Textual content | Google Scholar
25. Spherical JL, Mazmanian SK. Inducible Foxp3+ regulatory T-cell improvement by a commensal bacterium of the intestinal microbiota. Proc Natl Acad Sci USA. (2010) 107:12204–9. doi: 10.1073/pnas.0909122107 PubMed Summary | CrossRef Full Textual content | Google Scholar
26. Taylor A, Hale J, Wiltschut J, Lehmann H, Dunstan JA, Prescott SL. Analysis of the results of probiotic supplementation from the neonatal interval on innate immune improvement in infancy. Clin Exp Allergy. (2006) 36:1218–26. doi: 10.1111/j.1365-2222.2006.02552.x PubMed Summary | CrossRef Full Textual content | Google Scholar
27. He B, Hoang TK, Wang T, Ferris M, Taylor CM, Tian X, et al. Resetting microbiota by Lactobacillus reuteri inhibits T reg deficiency–induced autoimmunity by way of adenosine A2A receptors. J Exp Med. (2017) 214:107–23. doi: 10.1084/jem.20160961 PubMed Summary | CrossRef Full Textual content | Google Scholar
28. Saeki H, Moore AM, Brown MJ, Hwang ST. Leading edge: secondary lymphoid-tissue chemokine (SLC) and CC chemokine receptor 7 (CCR7) take part within the emigration pathway of mature dendritic cells from theskin to regional lymph nodes. J Immunol. (1999) 162:2472–5. PubMed Summary | Google Scholar
29. Yan FF, Murugesan GR, Cheng HW. Results of probiotic supplementation on efficiency traits, bone mineralization, cecal microbial composition, cytokines and corticosterone in laying hens. Animal. (2019) 13:33–41. doi: 10.1017/S175173111800109X PubMed Summary | CrossRef Full Textual content | Google Scholar